circad | circRNAs associated with diseases

hsa_circRNA_100709/hsa_circ_0003570
Gene	FAM53B	Organism	Human
Genome Locus	chr10:126370175-126384781:-	Build	hg19
Disease	Infantile Hemangioma (IH)	ICD-10	Haemangioma, any site (D18.0)
DBLink	Link to database	PMID	29095957
Experimental Method
Sample Type	Tissues	Comparison	Infantile Hemangioma (IH) and adjacent normal tissues
Method for Estimation	Quantitative PCR and Microarrays	PCR Details	Detailed Experimental Procedure
Primers (Experimented)	Forward AAGATGGCACAGCACACGC Reverse CTGTCATTTTCCATAATTCCACA	Statistics	Fold Change : Upregulated, 140.473 pvalue : p=0.012
Citation
Fu, C, Lv, R, Xu, G, Zhang, L, Bi, J, Lin, L, Liu, X, Huo, R (2017). Circular RNA profile of infantile hemangioma by microarray analysis. PLoS ONE, 12, 11:e0187581.